This program estimates "split alignments" (typically for DNA) or "spliced alignments" (typically for RNA).
It reads candidate alignments of query sequences to a genome, and looks for a unique best alignment for each part of each query. It allows different parts of one query to match different parts of the genome. This is useful for DNA queries that cross rearrangement breakpoints, or RNA queries that cross splice junctions.
Assume the DNA reads are in a file called "q.fastq" (in fastq-sanger format), and the genome is in "genome.fasta" (in fasta format). We can do the alignment like this:
lastdb -m1111110 db genome.fasta lastal -Q1 -e120 db q.fastq | last-split > out.maf
Now we assume that "q.fastq" has reads from RNA forward strands. This time, we provide the genome information to last-split, which causes it to do spliced instead of split alignment, and also tells it where the splice signals are (GT, AG, etc):
lastdb -m1111110 db genome.fasta lastal -Q1 -e120 db q.fastq | last-split -g db > out.maf
This will favour splices starting at GT (and to a lesser extent GC and AT), and ending at AG (and to a lesser extent AC). However, it allows splices starting and ending anywhere. It also favours splices with introns of typical length, specified by a log-normal distribution (i.e. cis-splices). However, it allows arbitrary trans-splices between any two places in the genome. If you wish to turn off trans-splicing, add -t0 to the last-split options.
Unfortunately, the cis-splicing calculations can be slow, depending on various factors such as query sequence length. If it is too slow, please try the next recipe.
Here we use -c0 to turn off cis-splicing, and -t0.004 to specify a higher probability of trans-splicing:
lastdb -m1111110 db genome.fasta lastal -Q1 -e120 db q.fastq | last-split -c0 -t0.004 -g db > out.maf
| Q: | Before aligning RNA, should poly-A tails be trimmed? | 
|---|---|
| A: | It's not essential, but it might make things faster. Poly-A tracts tend to have many matches in the genome. By trimming, you can prevent lastal and last-split from wasting time on such matches. | 
For example, split alignment of DNA reads to a genome:
parallel-fastq "lastal -Q1 -e120 db | last-split" < q.fastq > out.maf
This requires GNU parallel to be installed (http://www.gnu.org/software/parallel/).
The output is in MAF(-like) format:
a score=150 mismap=0.000413 s chr21 15963638 25 + 48129895 TCAGATGAGGACCTAATTTATTACT s query7 50 25 + 75 TCAGATGAGGACCTAATTTATTACT q query7 EBEEC@CE=EEE?FEDAED5?@@D@ p !#$'BBBBBBBBBBBBBBBBBBBBB
The "mismap" is the estimated probability that this part of the query should be aligned to a different part of the genome. The line starting with "p" indicates the probability that each base should be aligned to a different part of the genome. It uses a compact code:
Symbol Error probability Symbol Error probability ! 0.79 -- 1 0 0.025 -- 0.032 " 0.63 -- 0.79 1 0.02 -- 0.025 # 0.5 -- 0.63 2 0.016 -- 0.02 $ 0.4 -- 0.5 3 0.013 -- 0.016 % 0.32 -- 0.4 4 0.01 -- 0.013 & 0.25 -- 0.32 5 0.0079 -- 0.01 ' 0.2 -- 0.25 6 0.0063 -- 0.0079 ( 0.16 -- 0.2 7 0.005 -- 0.0063 ) 0.13 -- 0.16 8 0.004 -- 0.005 * 0.1 -- 0.13 9 0.0032 -- 0.004 + 0.079 -- 0.1 : 0.0025 -- 0.0032 , 0.063 -- 0.079 ; 0.002 -- 0.0025 - 0.05 -- 0.063 < 0.0016 -- 0.002 . 0.04 -- 0.05 = 0.0013 -- 0.0016 / 0.032 -- 0.04 > 0.001 -- 0.0013 
Other symbols indicate lower error probabilities, and "~" is the lowest possible. In general:
Error probability <= 10 ^ -((ASCII value - 33) / 10)
The "mismap" is simply the lowest probability from the "p" line.
Here is a split alignment:
Query         ttctttgat--gctagtcctgatgttatggtattttttatcgaatgataa
                |||||||--||||||                |||x||||||||||||
Genome chrA  ...ctttgatatgctagt...             |||x||||||||||||
Genome chrB                                 ...tttatatcgaatgata...
And here is a spliced alignment:
Query        ctagtcgatatt--gctgtacgtctgttagctat-tttttcctctgtttg
                |||x|||||--|||||||||----|||||||-|||||x|||||
Genome chrA  ...gtctatattatgctgtacgt... |||||||-|||||x|||||
Genome chrB                          ...tagctatattttttctctg...
Split alignment allows arbitrarily large unaligned parts in the middle of the query, whereas spliced alignment applies a standard gap penalty. (Both allow arbitrarily large unaligned parts at the edges of the query.)
For DNA queries, you might wish to try "trans-spliced" alignment without considering splice signals:
lastdb -m1111110 db genome.fasta lastal -Q1 -e120 db q.fastq | last-split -c0 > out.maf
-h, --help Show a help message, with default option values, and exit. -g, --genome=NAME Do spliced alignment, and read splice signals (GT, AG, etc) from the named genome. NAME should be the name of a lastdb database. -d, --direction=D Do spliced alignment, and set the strandedness of the queries: 0=reverse, 1=forward, 2=unknown/mixed. This determines whether forward and/or reverse-complement splice signals are used. -c, --cis=PROB Do spliced alignment, and set the average probability per base of cis-splicing. The default value roughly fits human RNA. -t, --trans=PROB Do spliced alignment, and set the average probability per base of trans-splicing. -M, --mean=MEAN Do spliced alignment, and set the mean of ln(intron length). The default value fits human RNA. -S, --sdev=SDEV Do spliced alignment, and set the standard deviation of ln(intron length). The default value fits human RNA. -m, --mismap=PROB Don't write alignments with mismap probability > PROB. Low-confidence alignments will be discarded unless you increase this value! -s, --score=INT Don't write alignments with score < INT. The default value is somewhat higher than the lastal score threshold. Specifically, it is e + t * ln(1000), where e is the score threshold, and t is a scale factor that is written in the lastal header. This roughly means that, for every alignment it writes, it has considered alternative alignments with one-thousandth the probability. -n, --no-split Do probability calculations as usual, but write the original alignments, annotated with "p" lines and mismap probabilities. Note that the mismap and score limits still apply. -v, --verbose Show progress information on the screen. -V, --version Show version information and exit. 
The following points matter only if you are doing something unusual (e.g. bisulfite alignment):
last-split does not support: